Review



negative control scrambled synthetic guide rna  (Synthego Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Synthego Inc negative control scrambled synthetic guide rna
    Genetic depletion of SOX11 reduced the expression of PAX5 and CD19. (A) CRISPR/Cas9- and short hairpin <t>RNA</t> (shRNA)-mediated knockdown of SOX11 resulted in reduced protein levels of PAX5 and CD19 in JeKo-1 and Z-138 cells. SCR refers to the scramble control; sg_SOX11 indicates <t>guide</t> <t>RNAs</t> C1 and C2; sh_SOX11 represents shRNA constructs C1 and C2, respectively. (B) Genetic knockdown of SOX11 led to reduced phosphorylation of downstream BCR signaling components. SOX11-deficient cells were stimulated with 5 μg/mL of IgM for 10 minutes, followed by immunoblot analysis of whole-cell lysates. (C) Overexpression of SOX11, tagged with 3XFlag, induces elevated levels of PAX5 and CD19 expression in the MAVER-1 and JeKo-1 cell lines. (D) Ectopic expression of SOX11 resulted in an increased level of PAX5 and CD19 in the SOX11-negative cell line JVM-2. Immunoblot experiments were performed to validate the results, and β-actin was used as a loading control to ensure equivalent loading and transfer. SCR, scramble control; sg_SOX11, guide RNAs C1 and C2; sh_SOX11, shRNA constructs C1 and C2.
    Negative Control Scrambled Synthetic Guide Rna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+scrambled+synthetic+guide+rna/pmc12744261-40-9-18?v=Synthego+Inc
    Average 86 stars, based on 1 article reviews
    negative control scrambled synthetic guide rna - by Bioz Stars, 2026-07
    86/100 stars

    Images

    1) Product Images from "SOX11 modulates BCR signaling through the PAX5/CD19 axis for therapeutic targeting in BTK-resistant mantle cell lymphoma"

    Article Title: SOX11 modulates BCR signaling through the PAX5/CD19 axis for therapeutic targeting in BTK-resistant mantle cell lymphoma

    Journal: Blood Advances

    doi: 10.1182/bloodadvances.2025016801

    Genetic depletion of SOX11 reduced the expression of PAX5 and CD19. (A) CRISPR/Cas9- and short hairpin RNA (shRNA)-mediated knockdown of SOX11 resulted in reduced protein levels of PAX5 and CD19 in JeKo-1 and Z-138 cells. SCR refers to the scramble control; sg_SOX11 indicates guide RNAs C1 and C2; sh_SOX11 represents shRNA constructs C1 and C2, respectively. (B) Genetic knockdown of SOX11 led to reduced phosphorylation of downstream BCR signaling components. SOX11-deficient cells were stimulated with 5 μg/mL of IgM for 10 minutes, followed by immunoblot analysis of whole-cell lysates. (C) Overexpression of SOX11, tagged with 3XFlag, induces elevated levels of PAX5 and CD19 expression in the MAVER-1 and JeKo-1 cell lines. (D) Ectopic expression of SOX11 resulted in an increased level of PAX5 and CD19 in the SOX11-negative cell line JVM-2. Immunoblot experiments were performed to validate the results, and β-actin was used as a loading control to ensure equivalent loading and transfer. SCR, scramble control; sg_SOX11, guide RNAs C1 and C2; sh_SOX11, shRNA constructs C1 and C2.
    Figure Legend Snippet: Genetic depletion of SOX11 reduced the expression of PAX5 and CD19. (A) CRISPR/Cas9- and short hairpin RNA (shRNA)-mediated knockdown of SOX11 resulted in reduced protein levels of PAX5 and CD19 in JeKo-1 and Z-138 cells. SCR refers to the scramble control; sg_SOX11 indicates guide RNAs C1 and C2; sh_SOX11 represents shRNA constructs C1 and C2, respectively. (B) Genetic knockdown of SOX11 led to reduced phosphorylation of downstream BCR signaling components. SOX11-deficient cells were stimulated with 5 μg/mL of IgM for 10 minutes, followed by immunoblot analysis of whole-cell lysates. (C) Overexpression of SOX11, tagged with 3XFlag, induces elevated levels of PAX5 and CD19 expression in the MAVER-1 and JeKo-1 cell lines. (D) Ectopic expression of SOX11 resulted in an increased level of PAX5 and CD19 in the SOX11-negative cell line JVM-2. Immunoblot experiments were performed to validate the results, and β-actin was used as a loading control to ensure equivalent loading and transfer. SCR, scramble control; sg_SOX11, guide RNAs C1 and C2; sh_SOX11, shRNA constructs C1 and C2.

    Techniques Used: Expressing, CRISPR, shRNA, Knockdown, Control, Construct, Phospho-proteomics, Western Blot, Over Expression



    Similar Products

    negative control scrambled synthetic guide rna  (Synthego Inc)
    86
    Synthego Inc negative control scrambled synthetic guide rna
    Genetic depletion of SOX11 reduced the expression of PAX5 and CD19. (A) CRISPR/Cas9- and short hairpin <t>RNA</t> (shRNA)-mediated knockdown of SOX11 resulted in reduced protein levels of PAX5 and CD19 in JeKo-1 and Z-138 cells. SCR refers to the scramble control; sg_SOX11 indicates <t>guide</t> <t>RNAs</t> C1 and C2; sh_SOX11 represents shRNA constructs C1 and C2, respectively. (B) Genetic knockdown of SOX11 led to reduced phosphorylation of downstream BCR signaling components. SOX11-deficient cells were stimulated with 5 μg/mL of IgM for 10 minutes, followed by immunoblot analysis of whole-cell lysates. (C) Overexpression of SOX11, tagged with 3XFlag, induces elevated levels of PAX5 and CD19 expression in the MAVER-1 and JeKo-1 cell lines. (D) Ectopic expression of SOX11 resulted in an increased level of PAX5 and CD19 in the SOX11-negative cell line JVM-2. Immunoblot experiments were performed to validate the results, and β-actin was used as a loading control to ensure equivalent loading and transfer. SCR, scramble control; sg_SOX11, guide RNAs C1 and C2; sh_SOX11, shRNA constructs C1 and C2.
    Negative Control Scrambled Synthetic Guide Rna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/negative+control+scrambled+synthetic+guide+rna/pmc12744261-40-9-18?v=Synthego+Inc
    Average 86 stars, based on 1 article reviews
    negative control scrambled synthetic guide rna - by Bioz Stars, 2026-07
    86/100 stars
    		  Buy from Supplier

    Image Search Results


    Genetic depletion of SOX11 reduced the expression of PAX5 and CD19. (A) CRISPR/Cas9- and short hairpin RNA (shRNA)-mediated knockdown of SOX11 resulted in reduced protein levels of PAX5 and CD19 in JeKo-1 and Z-138 cells. SCR refers to the scramble control; sg_SOX11 indicates guide RNAs C1 and C2; sh_SOX11 represents shRNA constructs C1 and C2, respectively. (B) Genetic knockdown of SOX11 led to reduced phosphorylation of downstream BCR signaling components. SOX11-deficient cells were stimulated with 5 μg/mL of IgM for 10 minutes, followed by immunoblot analysis of whole-cell lysates. (C) Overexpression of SOX11, tagged with 3XFlag, induces elevated levels of PAX5 and CD19 expression in the MAVER-1 and JeKo-1 cell lines. (D) Ectopic expression of SOX11 resulted in an increased level of PAX5 and CD19 in the SOX11-negative cell line JVM-2. Immunoblot experiments were performed to validate the results, and β-actin was used as a loading control to ensure equivalent loading and transfer. SCR, scramble control; sg_SOX11, guide RNAs C1 and C2; sh_SOX11, shRNA constructs C1 and C2.

    Journal: Blood Advances

    Article Title: SOX11 modulates BCR signaling through the PAX5/CD19 axis for therapeutic targeting in BTK-resistant mantle cell lymphoma

    doi: 10.1182/bloodadvances.2025016801

    Figure Lengend Snippet: Genetic depletion of SOX11 reduced the expression of PAX5 and CD19. (A) CRISPR/Cas9- and short hairpin RNA (shRNA)-mediated knockdown of SOX11 resulted in reduced protein levels of PAX5 and CD19 in JeKo-1 and Z-138 cells. SCR refers to the scramble control; sg_SOX11 indicates guide RNAs C1 and C2; sh_SOX11 represents shRNA constructs C1 and C2, respectively. (B) Genetic knockdown of SOX11 led to reduced phosphorylation of downstream BCR signaling components. SOX11-deficient cells were stimulated with 5 μg/mL of IgM for 10 minutes, followed by immunoblot analysis of whole-cell lysates. (C) Overexpression of SOX11, tagged with 3XFlag, induces elevated levels of PAX5 and CD19 expression in the MAVER-1 and JeKo-1 cell lines. (D) Ectopic expression of SOX11 resulted in an increased level of PAX5 and CD19 in the SOX11-negative cell line JVM-2. Immunoblot experiments were performed to validate the results, and β-actin was used as a loading control to ensure equivalent loading and transfer. SCR, scramble control; sg_SOX11, guide RNAs C1 and C2; sh_SOX11, shRNA constructs C1 and C2.

    Article Snippet: CRISPRevolution synthetic guide RNAs targeting SOX11 (sequence: CCGGGAGGCGCUGGACACGG) and negative control scrambled synthetic guide RNA were procured from Synthego.

    Techniques: Expressing, CRISPR, shRNA, Knockdown, Control, Construct, Phospho-proteomics, Western Blot, Over Expression